Hi Matthias and others,
I noticed the read length discordance myself very recently, and
was going to bring it up. This is really unfortunate - people
processing the data in Barcelona didn't follow the explicit
instructions of submitting 75 bp data. This is something that I
should have checked though, and I thought I had, but apparently I
didn't for the mRNA data. However, I don't think this will really
affect things. The Barcelona samples don't show worse mapping
stats, and I definitely don't want to remap these samples without
a very strong reason.
Regarding the GEM mapping quality scores,
Paolo, Thasso and
Micha, can you please comment on this? Matthias and
Daniela, what do you mean by referring to the example reads as
being well or badly mapped? The classifications below is the
information I have from Paolo, but I don't know the algorithms
that they use to calculate the MAPQ. In my understanding the
qualities are calculated independently for the two mates. I'm
using reads with MAPQ >150, i.e. reads in categories 1 and 2
below. It depends on the analysis whether I require both mates to
have this quality (e.g. exon quantifications) or if I can just use
a single good-quality mate regardless of the quality of its mate
(e.g. ASE).
- Matches which are unique, and do not have any subdominant
match:
251 >= MAPQ >= 255, XT=U
- Matches which are unique, and have subdominant matches but a
different score:
175 >= MAPQ >= 181, XT=U
- Matches which are putatively unique (not unique, but
distinguishable by score):
119 >= MAPQ >= 127, XT=U
- Matches which are a perfect tie:
78 >= MAPQ >= 90, XT=R.
best regards,
Tuuli
Tuuli Lappalainen, PhD
Department of Genetic Medicine and Development
University of Geneva Medical School
CMU / Rue Michel-Servet 1
1211 Geneva 4
Switzerland
Tel. +41-(0)22-3795550
tuuli.lappalainen@unige.ch
On 7/4/12 3:24 PM, Matthias Barann wrote:
Dear all,
we noticed some inconsistencies in the read lengths of the GEM
mappings (I didn't check the BWA mappings, but it's probably the
same).
Some samples appear to have up to 76 bp matched, while other
samples only have 75 bp. In regard to comparability this might
cause some (probably very little) differences between the samples.
i.e.
NA20589.1.M_111124_3.bam has 75 bp
NA20812.2.M_111216_6.bam has 76 bp
NA20760.3.M_120202_5.bam has 75 bp
NA20783.4.M_120208_6.bam has 75 bp
NA20768.5.M_120131_1.bam has 75 bp
NA20798.6.M_120119_6.bam has 75 bp
NA20803.7.M_120219_1.bam has 75 bp
We checked some more files for institute 2, and they seem to have
generally 1 bp more than the others.
We're also a bit lost regarding GEM's quality score. We would like
to filter reads for good mapping quality, we're just not sure how
to accomplish this.
Below are two read pairs as an example.
The fist pair has a mapping quality of 180. The second read
however was terribly aligned.
The second pair has only a quality of 99, while the reads mapped
much better (at least I would say so).
We're not sure what's the reason for this.
Curiously, both reads of a pair get the same mapping quality. This
could be by intention (i.e. it's always the pair quality rather
than the read quality) or, which could also explain the quality
differences for the reads, both reads of the pair get the quality
of the first mapped read.
We're thankful for any suggestions on how to filter for 'good'
mappings.
HWI-ST661:153:D0FTJACXX:8:2201:16410:93092
163 chr1 14704 180 75M = 14770
-134
CCCAGTCGTCCTCGTCCTCCTCTGCCTGTGGCTGCTGCGGTGGCGGCAGAGGAGGGATGGAGGCTGACACGCGGG
CCCFFFFFHHHGHJJJIGIJIIIIIJIJHIIJJJB?BFHG7@F@AB:9=(6=(;>B29<@###############
RG:Z:0 NM:i:7 XT:A:U md:Z:62T12
XA:Z:chr15,-102516387,75M,8;chr9,+14815,75M,10;chr16,+64389,19M1I1M2I52M,10;chr2,-114356235,75M,11;
HWI-ST661:153:D0FTJACXX:8:2201:16410:93092 83 chr1
14770 180 39M1D22M1I3M2I1M1I2M4S = 14704
134
ACACGCGGGCAAAGGCTCCTCCGGGCCCCTCACCAGCCCAGGTCCTTTCCCAGAGATGCCTTGGCTCGTGGCTGT
5@
9DDDDDDDDDC@BDDDDDDFHHIIIIJIHFJJJJIIJIJIJJIJJJJJJJJJJIIIJJJJHHHHHFFDDA11B
RG:Z:0 NM:i:7 XT:A:U
md:Z:(4)2>1-1>2-T2>1-22>1+39
XA:Z:chr15,+102516328,1S1M2I4M3I1M1I1M1I24M1D36M,8;chr9,-14881,39M1D22M1I3M2
I1M1I2M4S,10;chr16,-64452,39M1D22M1I3M2I1M1I2M4S,10;chr2,+114356176,1S1M2I4M3I1M1I1M1I24M1D36M,11;
HWI-ST661:153:D0FTJACXX:8:2201:6270:52066
99 chr1 14582 99 1M2I71M1S =
14665 158
CCCTGGTTCCGTCACCCCCTCCCAGGGAAGCAGGTCTGAGCAGCTTGTCCTGGCTGTGTCAATGTCAGAGCAACA
@11ADFFFHHHHHIIJJJJIJJIJJJJHHJJIJJHIJJJIIGFGIIJIIJF@@EGDAE>?)).7?BDFFDCCCB@
RG:Z:0 NM:i:8 XT:A:U md:Z:1>2-21A5T29C13(1)
XA:Z:chrY,-59358087,75M,4;chrX,-155255081,75M,4;chr9,+14691,75M,7;chr2,-114356359,75M,7;chr16,+64266,75M,8;chr12,-90971,75M,8;
HWI-ST661:153:D0FTJACXX:8:2201:6270:52066 147 chr1
14665 99 75M = 14582 -158
GGGTCTGGGGGGGAAGGTGTCATGGAGCCCCCTAGGATTCCCAGTCGTCCTCGTCCTCCTCTGCCTGTGGCTGTG
<B@A<9;>@CAAADDDDCCC>CC=?;>FHCGGEGIGJJIIGGIHHIIIIJIIJIJIGJJIJIHHFDDFFFFDB@;
RG:Z:0 NM:i:8 XT:A:U md:Z:AG38G34
XA:Z:chrY,+59358002,75M,4;chrX,+155254996,75M,4;chr9,-14776,75M,7;chr2,+114356274,75M,7;chr16,-64350,58M1I1M2I11M1D2M,8;chr12,+90885,2M1D73M,8;
best wishes,
Matthias & Daniela
--
Matthias Barann
Institute of Clinical Molecular Biology
Christian Albrechts University Kiel
Schittenhelmstr. 12
D-24105 Kiel, Germany
m.barann@ikmb.uni-kiel.de
+49 - (0)431 - 597 8681 (office)
_______________________________________________
Geuvadis_rna_analysis mailing list
Geuvadis_rna_analysis@lists.crg.es
http://davinci.crg.es/mailman/listinfo/geuvadis_rna_analysis