geuvadis_rna_analysis February 2012

geuvadis_rna_analysis@lists.crg.es

13 participants
16 discussions

[Geuvadis_rna_analysis] Geuvadis RNAseq analysis group TC

by Tuuli Lappalainen

Dear all, We'll have our Geuvadis RNAseq analysis group call again today (Thursday) at 2pm. Things to be discussed: - update on sequencing progress - miRNA QC issues - Tuuli will present some slides on how genetic variants affect mapability, and ways to correct for it - mRNA and miRNA data processing pipelines Call details: Spain 902 125 136 Other countries +34 91 495 18 99 Participants' Pin-code: 764989* best regards, Tuuli -- Tuuli Lappalainen, PhD Department of Genetic Medicine and Development University of Geneva Medical School CMU / Rue Michel-Servet 1 1211 Geneva 4 Switzerland Tel. +41-(0)22-3795550 tuuli.lappalainen(a)unige.ch

12 years, 7 months

[Geuvadis_rna_analysis] Geuvadis RNAseq lab IDs

by Tuuli Lappalainen

Hello, We've found a slight discrepancy in the Geuvadis RNAseq lab ID number info. This is due to my mistake: In the RNAseq protocol text in November there's a table of lab IDs, but then I forgot about this and assigned partly different IDs when sending out the sample information sheets. This caused some confusion now that we've actually had data to exchange. Sorry about this, but I'm glad we caught it early (thanks Peter, Matthias, Olof). From now on, please use the following IDs that correspond to the sample information sheets. I also enclosed the sequencing protocol with an updated table. Because of this error, in the miRNAseq QC slides from Matthias the samples labeled as Leiden are actually from Uppsala. have a nice weekend, Tuuli Correct Lab # # in the previous protocol table UNIGE (Geneva) 1 1 CRG (Barcelona) 2 2 MPIMG (Berlin) 3 3 ICMB (Kiel) 4 4 HMGU (Munich) 5 7 UU (Uppsala) 6 5 LUMC (Leiden) 7 6 -- Tuuli Lappalainen, PhD Department of Genetic Medicine and Development University of Geneva Medical School CMU / Rue Michel-Servet 1 1211 Geneva 4 Switzerland Tel. +41-(0)22-3795550 tuuli.lappalainen(a)unige.ch

12 years, 7 months

[Geuvadis_rna_analysis] Fwd: Fwd: Re: Geuvadis RNAseq analysis group TC - slides

by Tuuli Lappalainen

Hello, Here are miRNA QC results of the replicate samples from Matthias. best regards, Tuuli Tuuli Lappalainen, PhD Department of Genetic Medicine and Development University of Geneva Medical School CMU / Rue Michel-Servet 1 1211 Geneva 4 Switzerland Tel. +41-(0)22-3795550 tuuli.lappalainen(a)unige.ch -------- Original Message -------- Subject: Fwd: Re: [Geuvadis_rna_analysis] Geuvadis RNAseq analysis group TC - slides Date: Thu, 23 Feb 2012 16:28:23 +0100 From: Matthias Barann <m.barann(a)ikmb.uni-kiel.de> To: Tuuli Lappalainen <Tuuli.Lappalainen(a)unige.ch> Hello Tuuli, could you please try to forward the attached pdf file to the others. I tried it in three different ways (as excel sheet, zip file and pdf) but always get an error. Thanks, Matthias -------- Original Message -------- Subject: Re: [Geuvadis_rna_analysis] Geuvadis RNAseq analysis group TC - slides Date: Thu, 23 Feb 2012 16:26:39 +0100 From: Matthias Barann <m.barann(a)ikmb.uni-kiel.de> To: geuvadis_rna_analysis(a)lists.crg.es Dear all, here is the quality analysis we have done on the common miRNA samples. There's one sample which shows a weird read-length for the genome mapping (NA20527, page 11-12). However, in the miRNA mapping it's not that much different anymore, but it misses some more miRNAs (page 6). And there are a few samples which show almost equal amounts of short reads (14 bp) compared to the number of 22 bp reads. Everything else looks quite similar. One other thing I noticed is, that the sample NA19095 seems to contain a (very little) bit more poly-A tagged RNAs (page 2, upper graph). This is probably due to the extraction, as all institutes have roughly the same amount of polyA-trimmed reads for the same samples. For mapping only reads were used, which had the adapter successfully removed. best wishes, Matthias -- Matthias Barann Institute of Clinical Molecular Biology Christian Albrechts University Kiel Schittenhelmstr. 12 D-24105 Kiel, Germany m.barann(a)ikmb.uni-kiel.de +49 - (0)431 - 597 8681 (office)

12 years, 7 months

[Geuvadis_rna_analysis] Geuvadis RNAseq abstract for Biology of Genomes

by Tuuli Lappalainen

Dear all, Here is the Geuvadis RNAseq draft for the abstract for the Biology of Genomes meeting. Please *comment and give your author and affiliation info by Tuesday Feb 21*. Regarding the author list: The length limitation includes author & affiliation info, so we need to keep it very short for this abstract. We suggest the following: - analysis people with major contribution: Tuuli Lappalainen, Michael Sammeth, Natalja Kurbatova, Tim Strom, Peter t' Hoen, Matthias Barann, Marc Sultan, Esther Lizano, Manuel Rivas. If someone else feels that they should be included, we can try to squeeze in an additional name or two. - One PI per institute - *Kiel and Berlin, please indicate who*: Alvis Brazma, Ann-Christine Syvanen, Thomas Meitinger, Gert-Jan van Ommen, Philip Rosenstiel */* Stefan Schreiber, Ralf Sudbrak */* Hans Lehrach, Ivo Gut, Xavier Estivill, Emmanouil T Dermitzakis - and last: "on behalf of the Geuvadis Consortium" *Everyone on the author list: please reply to this email with your name and affiliation info. *Due to length limitations, please include only your Geuvadis partner affiliation and use abbreviations when possible. best regards, Tuuli Author information example: First name: Tuuli Middle initial: Last name: Lappalainen Email: tuuli.lappalainen(a)unige.ch Affiliation name: University of Geneva Department: Dept of Genetic Medicine and Development Street: R. Michel Servet 1 City : Geneva Postal code: 1211 4 Country: Switzerland -- Tuuli Lappalainen, PhD Department of Genetic Medicine and Development University of Geneva Medical School CMU / Rue Michel-Servet 1 1211 Geneva 4 Switzerland Tel. +41-(0)22-3795550 tuuli.lappalainen(a)unige.ch

12 years, 8 months

[Geuvadis_rna_analysis] miRNA test file upload

by Tuuli Lappalainen

Hello, So, I'd like to ask all the labs that have miRNA data to upload 3 fastq files to the ftp site. I just uploaded our files, and I'll be expecting files from Barcelona (Marta/Esther/Sergi), Berlin (Marc), Kiel (Matthias). Does Munich have miRNA data? Please do this asap. Detailed instructions: - upload to ftp-private.ebi.ac.uk/upload/geuvadis/wp4_rnaseq/main_project/working/miRNA_QC . User geuvadis, password k2vP3kjJ . - to make the file processing easy, please name the fastq files according to the naming instructions: SAMPLE_ID.SeqLabNumber.MI_YYMMDD_Lane_1.fastq.gz . The lab numbers are: Geneva=1, Barcelona=2, Berlin=3, Kiel=4, Munich=5. E.g. one of our files is HG00096.1.MI_120104_4_1.fastq.gz - choose 3 random files, or pick ones that have a little bit different numbers of total reads - upload also a readme file with at least your name and email and the read length - use raw fastq files without any adaptor trimming, or if you want, you can trim all the reads to 36 bp thanks, Tuuli -- Tuuli Lappalainen, PhD Department of Genetic Medicine and Development University of Geneva Medical School CMU / Rue Michel-Servet 1 1211 Geneva 4 Switzerland Tel. +41-(0)22-3795550 tuuli.lappalainen(a)unige.ch

12 years, 8 months

[Geuvadis_rna_analysis] miRNA quality comparison

by Matthias Barann

Dear all, here is our analysis of the miRNA samples of 4 institutes (UNIGE, MPIMG, ICMB, CNAG, see attatched pdf file). This is basically what I did: 1. trim reads to 36 bp (prinseq). 2. remove adapter sequence (cutadapt), split into trimmed reads and untrimmed reads 3. remove polyA tails (cutadapt) 4. map trimmed reads against genome and miRNA reference (the one from the FTP server). 5. count reads per miRNA There are larger differences considering the amount of adapter sequences within the samples and the library diversity. best wishes, Matthias -- Matthias Barann Institute of Clinical Molecular Biology Christian Albrechts University Kiel Schittenhelmstr. 12 D-24105 Kiel, Germany m.barann(a)ikmb.uni-kiel.de +49 - (0)431 - 597 8681 (office)

12 years, 8 months

[Geuvadis_rna_analysis] Geuvadis RNAseq TC Minutes

by Tuuli Lappalainen

Hello all, Please find the Geuvadis RNAseq TC minutes enclosed. Action items: -All the labs with miRNA data (everyone except Leiden, Uppsala?) should upload 3 fastq files (preferably of different read counts; before any trimming) to the ftp site, to /upload/geuvadis/wp4_rnaseq/main_project/working/miRNA_QC. Then everyone should analyze these files using their standard methods to make sure that the data from different labs is of comparable quality. These analyses need to be done asap. -UNIGE will finish the details of invoicing the cell & RNA costs -Tuuli will write and send around an abstract for Biology of Genomes best regards, Tuuli -- Tuuli Lappalainen, PhD Department of Genetic Medicine and Development University of Geneva Medical School CMU / Rue Michel-Servet 1 1211 Geneva 4 Switzerland Tel. +41-(0)22-3795550 tuuli.lappalainen(a)unige.ch

12 years, 8 months

[Geuvadis_rna_analysis] it works now

by Tuuli Lappalainen

Tuuli Lappalainen, PhD Department of Genetic Medicine and Development University of Geneva Medical School CMU / Rue Michel-Servet 1 1211 Geneva 4 Switzerland Tel. +41-(0)22-3795550 tuuli.lappalainen(a)unige.ch -------- Original Message -------- Subject: RE: Rut, it seems that they cannot connect to the call can you double check ? I´m in a meeting... Date: Tue, 14 Feb 2012 16:09:07 +0100 From: Rut Carbonell Garcia <rut.carbonell(a)crg.eu> To: Esther Lizano <Esther.Lizano(a)crg.eu>, Gabrielle Anne Bertier <gabrielle.bertier(a)crg.eu> CC: Tuuli Lappalainen <Tuuli.Lappalainen(a)unige.ch> Try it now please *De:*Esther Lizano *Enviado el:* martes, 14 de febrero de 2012 16:06 *Para:* Gabrielle Anne Bertier *CC:* Tuuli Lappalainen; Rut Carbonell Garcia *Asunto:* Re: Rut, it seems that they cannot connect to the call can you double check ? I´m in a meeting... the problem is the pin code, it says invalid. could we use the coordinator pin? On 2/14/12 4:04 PM, Gabrielle Anne Bertier wrote: *_14th of February at 4-5pm, 15 ppl_* Spain 902 125 136 Other countries +34 91 495 18 99 Participants' Pin-code: 764989* *From:*geuvadis_rnaseq-bounces@lists.crg.es <mailto:geuvadis_rnaseq-bounces@lists.crg.es> [mailto:geuvadis_rnaseq-bounces@lists.crg.es] *On Behalf Of *Tuuli Lappalainen *Sent:* Tuesday, February 14, 2012 4:02 PM *Cc:* geuvadis_rnaseq(a)lists.crg.es <mailto:geuvadis_rnaseq@lists.crg.es>; geuvadis_rna_analysis(a)lists.crg.es <mailto:geuvadis_rna_analysis@lists.crg.es> *Subject:* Re: [Geuvadis_rnaseq] [Geuvadis_rna_analysis] Geuvadis RNAseq TC today at 4pm These were the codes that I got from Gabrielle, I hope that she can fix this! Tuuli Tuuli Lappalainen, PhD Department of Genetic Medicine and Development University of Geneva Medical School CMU / Rue Michel-Servet 1 1211 Geneva 4 Switzerland Tel. +41-(0)22-3795550 tuuli.lappalainen(a)unige.ch <mailto:tuuli.lappalainen@unige.ch> On 2/14/12 4:01 PM, M.Sammeth wrote: invalid code 764989* On Tue, Feb 14, 2012 at 3:46 PM, Tuuli Lappalainen <Tuuli.Lappalainen(a)unige.ch <mailto:Tuuli.Lappalainen@unige.ch>> wrote: Sorry - here's the attachment. Tuuli Lappalainen, PhD Department of Genetic Medicine and Development University of Geneva Medical School CMU / Rue Michel-Servet 1 1211 Geneva 4 Switzerland Tel.+41-(0)22-3795550 <tel:%2B41-%280%2922-3795550> tuuli.lappalainen(a)unige.ch <mailto:tuuli.lappalainen@unige.ch> On 2/14/12 3:45 PM, Tuuli Lappalainen wrote: Dear all, Here is a slide of small RNA quality analysis to discuss on the call. best regards, Tuuli Tuuli Lappalainen, PhD Department of Genetic Medicine and Development University of Geneva Medical School CMU / Rue Michel-Servet 1 1211 Geneva 4 Switzerland Tel.+41-(0)22-3795550 <tel:%2B41-%280%2922-3795550> tuuli.lappalainen(a)unige.ch <mailto:tuuli.lappalainen@unige.ch> On 2/14/12 12:37 PM, Tuuli Lappalainen wrote: Here are the call details Spain 902 125 136 Other countries +34 91 495 18 99 Participants' Pin-code: 764989* best regards, Tuuli Tuuli Lappalainen, PhD Department of Genetic Medicine and Development University of Geneva Medical School CMU / Rue Michel-Servet 1 1211 Geneva 4 Switzerland Tel.+41-(0)22-3795550 <tel:%2B41-%280%2922-3795550> tuuli.lappalainen(a)unige.ch <mailto:tuuli.lappalainen@unige.ch> On 2/14/12 9:18 AM, Tuuli Lappalainen wrote: Dear all, As a reminder, we have a Geuvadis RNAseq TC today (14th) at 4 PM. On the agenda: - update on sequencing progress - miRNA quality - RNAseq meetings April 16-17 in Geneva, future meetings? - cell line & RNA extraction costs - abstract for Biology of Genomes meeting at Cold Spring Harbor - collaborations best regards, Tuuli _______________________________________________ Geuvadis_rna_analysis mailing list Geuvadis_rna_analysis(a)lists.crg.es <mailto:Geuvadis_rna_analysis@lists.crg.es> http://davinci.crg.es/mailman/listinfo/geuvadis_rna_analysis _______________________________________________ Geuvadis_rnaseq mailing list Geuvadis_rnaseq(a)lists.crg.es <mailto:Geuvadis_rnaseq@lists.crg.es> http://davinci.crg.es/mailman/listinfo/geuvadis_rnaseq _______________________________________________ Geuvadis_rnaseq mailing list Geuvadis_rnaseq(a)lists.crg.es <mailto:Geuvadis_rnaseq@lists.crg.es> http://davinci.crg.es/mailman/listinfo/geuvadis_rnaseq -- Dr. Michael Sammeth, Functional Bioinformatics Phone: +34-934-020-580, http://www.cnag.eu Centre Nacional d'Anàlisi Genòmica (CNAG), PCB Baldiri Reixac 4-6, Room 02A8, 08028 Barcelona

12 years, 8 months

[Geuvadis_rna_analysis] Geuvadis RNAseq TC today at 4pm

by Tuuli Lappalainen

Dear all, As a reminder, we have a Geuvadis RNAseq TC today (14th) at 4 PM. On the agenda: - update on sequencing progress - miRNA quality - RNAseq meetings April 16-17 in Geneva, future meetings? - cell line & RNA extraction costs - abstract for Biology of Genomes meeting at Cold Spring Harbor - collaborations best regards, Tuuli -- Tuuli Lappalainen, PhD Department of Genetic Medicine and Development University of Geneva Medical School CMU / Rue Michel-Servet 1 1211 Geneva 4 Switzerland Tel. +41-(0)22-3795550 tuuli.lappalainen(a)unige.ch

12 years, 8 months

[Geuvadis_rna_analysis] small RNA basic QC

by Sergi Beltran Agulló

Dear all, please find attached a very basic QC for the 5 common samples plus an extra one (NA20524). We have not been able to fully test the pipeline in order to deliver this now, but it should be fine. We have seen different length profiles on the samples we have sequenced and 4 of the common ones have a more or less similar distribution. You will see that the extra one has very few reads and a different profile (mode at 15bp, also seen in NA20527). Workflow: 1) Trimming -> using far (fast adaptor removal) with a minimum of 6 bases overlap and a maximum mismatch of 2 bases every 10. We have done a very harsh trimming for this test; we can probably make it more strict and with several rounds. 2) Selection of uniquely mapping reads (mapping done with GEM+Bfast). 3) Generation of mature miRNA coordinates with tool from http://cm.jefferson.edu/downloadables/ 4) Reciprocal comparison (unique reads VS mature miRNA) with bedtools (only miRNA counts are attached here) The sequence that can clearly be read (CGCGACCTCAGATCAGACGTGGCGACCCGCTGA) has a "perfect" match with megablast on human genome. Best wishes, Sergi --------------------------------- Sergi Beltran Agulló Bioinformatics Analysis Group CNAG - National Center for Genomic Analysis Parc Científic Barcelona - Torre I Baldiri i Reixac 4, 2a p. 08028 Barcelona (+34)934033748 sbeltrana(a)pcb.ub.cat www.cnag.cat ---------------------------------

12 years, 8 months

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

geuvadis_rna_analysis February 2012