geuvadis_rna_analysis

geuvadis_rna_analysis@lists.crg.es

160 discussions

[Geuvadis_rna_analysis] miRNA quality comparison

by Matthias Barann

Dear all, here is our analysis of the miRNA samples of 4 institutes (UNIGE, MPIMG, ICMB, CNAG, see attatched pdf file). This is basically what I did: 1. trim reads to 36 bp (prinseq). 2. remove adapter sequence (cutadapt), split into trimmed reads and untrimmed reads 3. remove polyA tails (cutadapt) 4. map trimmed reads against genome and miRNA reference (the one from the FTP server). 5. count reads per miRNA There are larger differences considering the amount of adapter sequences within the samples and the library diversity. best wishes, Matthias -- Matthias Barann Institute of Clinical Molecular Biology Christian Albrechts University Kiel Schittenhelmstr. 12 D-24105 Kiel, Germany m.barann(a)ikmb.uni-kiel.de +49 - (0)431 - 597 8681 (office)

12 years, 8 months

[Geuvadis_rna_analysis] Geuvadis RNAseq TC Minutes

by Tuuli Lappalainen

Hello all, Please find the Geuvadis RNAseq TC minutes enclosed. Action items: -All the labs with miRNA data (everyone except Leiden, Uppsala?) should upload 3 fastq files (preferably of different read counts; before any trimming) to the ftp site, to /upload/geuvadis/wp4_rnaseq/main_project/working/miRNA_QC. Then everyone should analyze these files using their standard methods to make sure that the data from different labs is of comparable quality. These analyses need to be done asap. -UNIGE will finish the details of invoicing the cell & RNA costs -Tuuli will write and send around an abstract for Biology of Genomes best regards, Tuuli -- Tuuli Lappalainen, PhD Department of Genetic Medicine and Development University of Geneva Medical School CMU / Rue Michel-Servet 1 1211 Geneva 4 Switzerland Tel. +41-(0)22-3795550 tuuli.lappalainen(a)unige.ch

12 years, 8 months

[Geuvadis_rna_analysis] it works now

by Tuuli Lappalainen

Tuuli Lappalainen, PhD Department of Genetic Medicine and Development University of Geneva Medical School CMU / Rue Michel-Servet 1 1211 Geneva 4 Switzerland Tel. +41-(0)22-3795550 tuuli.lappalainen(a)unige.ch -------- Original Message -------- Subject: RE: Rut, it seems that they cannot connect to the call can you double check ? I´m in a meeting... Date: Tue, 14 Feb 2012 16:09:07 +0100 From: Rut Carbonell Garcia <rut.carbonell(a)crg.eu> To: Esther Lizano <Esther.Lizano(a)crg.eu>, Gabrielle Anne Bertier <gabrielle.bertier(a)crg.eu> CC: Tuuli Lappalainen <Tuuli.Lappalainen(a)unige.ch> Try it now please *De:*Esther Lizano *Enviado el:* martes, 14 de febrero de 2012 16:06 *Para:* Gabrielle Anne Bertier *CC:* Tuuli Lappalainen; Rut Carbonell Garcia *Asunto:* Re: Rut, it seems that they cannot connect to the call can you double check ? I´m in a meeting... the problem is the pin code, it says invalid. could we use the coordinator pin? On 2/14/12 4:04 PM, Gabrielle Anne Bertier wrote: *_14th of February at 4-5pm, 15 ppl_* Spain 902 125 136 Other countries +34 91 495 18 99 Participants' Pin-code: 764989* *From:*geuvadis_rnaseq-bounces@lists.crg.es <mailto:geuvadis_rnaseq-bounces@lists.crg.es> [mailto:geuvadis_rnaseq-bounces@lists.crg.es] *On Behalf Of *Tuuli Lappalainen *Sent:* Tuesday, February 14, 2012 4:02 PM *Cc:* geuvadis_rnaseq(a)lists.crg.es <mailto:geuvadis_rnaseq@lists.crg.es>; geuvadis_rna_analysis(a)lists.crg.es <mailto:geuvadis_rna_analysis@lists.crg.es> *Subject:* Re: [Geuvadis_rnaseq] [Geuvadis_rna_analysis] Geuvadis RNAseq TC today at 4pm These were the codes that I got from Gabrielle, I hope that she can fix this! Tuuli Tuuli Lappalainen, PhD Department of Genetic Medicine and Development University of Geneva Medical School CMU / Rue Michel-Servet 1 1211 Geneva 4 Switzerland Tel. +41-(0)22-3795550 tuuli.lappalainen(a)unige.ch <mailto:tuuli.lappalainen@unige.ch> On 2/14/12 4:01 PM, M.Sammeth wrote: invalid code 764989* On Tue, Feb 14, 2012 at 3:46 PM, Tuuli Lappalainen <Tuuli.Lappalainen(a)unige.ch <mailto:Tuuli.Lappalainen@unige.ch>> wrote: Sorry - here's the attachment. Tuuli Lappalainen, PhD Department of Genetic Medicine and Development University of Geneva Medical School CMU / Rue Michel-Servet 1 1211 Geneva 4 Switzerland Tel.+41-(0)22-3795550 <tel:%2B41-%280%2922-3795550> tuuli.lappalainen(a)unige.ch <mailto:tuuli.lappalainen@unige.ch> On 2/14/12 3:45 PM, Tuuli Lappalainen wrote: Dear all, Here is a slide of small RNA quality analysis to discuss on the call. best regards, Tuuli Tuuli Lappalainen, PhD Department of Genetic Medicine and Development University of Geneva Medical School CMU / Rue Michel-Servet 1 1211 Geneva 4 Switzerland Tel.+41-(0)22-3795550 <tel:%2B41-%280%2922-3795550> tuuli.lappalainen(a)unige.ch <mailto:tuuli.lappalainen@unige.ch> On 2/14/12 12:37 PM, Tuuli Lappalainen wrote: Here are the call details Spain 902 125 136 Other countries +34 91 495 18 99 Participants' Pin-code: 764989* best regards, Tuuli Tuuli Lappalainen, PhD Department of Genetic Medicine and Development University of Geneva Medical School CMU / Rue Michel-Servet 1 1211 Geneva 4 Switzerland Tel.+41-(0)22-3795550 <tel:%2B41-%280%2922-3795550> tuuli.lappalainen(a)unige.ch <mailto:tuuli.lappalainen@unige.ch> On 2/14/12 9:18 AM, Tuuli Lappalainen wrote: Dear all, As a reminder, we have a Geuvadis RNAseq TC today (14th) at 4 PM. On the agenda: - update on sequencing progress - miRNA quality - RNAseq meetings April 16-17 in Geneva, future meetings? - cell line & RNA extraction costs - abstract for Biology of Genomes meeting at Cold Spring Harbor - collaborations best regards, Tuuli _______________________________________________ Geuvadis_rna_analysis mailing list Geuvadis_rna_analysis(a)lists.crg.es <mailto:Geuvadis_rna_analysis@lists.crg.es> http://davinci.crg.es/mailman/listinfo/geuvadis_rna_analysis _______________________________________________ Geuvadis_rnaseq mailing list Geuvadis_rnaseq(a)lists.crg.es <mailto:Geuvadis_rnaseq@lists.crg.es> http://davinci.crg.es/mailman/listinfo/geuvadis_rnaseq _______________________________________________ Geuvadis_rnaseq mailing list Geuvadis_rnaseq(a)lists.crg.es <mailto:Geuvadis_rnaseq@lists.crg.es> http://davinci.crg.es/mailman/listinfo/geuvadis_rnaseq -- Dr. Michael Sammeth, Functional Bioinformatics Phone: +34-934-020-580, http://www.cnag.eu Centre Nacional d'Anàlisi Genòmica (CNAG), PCB Baldiri Reixac 4-6, Room 02A8, 08028 Barcelona

12 years, 8 months

[Geuvadis_rna_analysis] Geuvadis RNAseq TC today at 4pm

by Tuuli Lappalainen

Dear all, As a reminder, we have a Geuvadis RNAseq TC today (14th) at 4 PM. On the agenda: - update on sequencing progress - miRNA quality - RNAseq meetings April 16-17 in Geneva, future meetings? - cell line & RNA extraction costs - abstract for Biology of Genomes meeting at Cold Spring Harbor - collaborations best regards, Tuuli -- Tuuli Lappalainen, PhD Department of Genetic Medicine and Development University of Geneva Medical School CMU / Rue Michel-Servet 1 1211 Geneva 4 Switzerland Tel. +41-(0)22-3795550 tuuli.lappalainen(a)unige.ch

12 years, 8 months

[Geuvadis_rna_analysis] small RNA basic QC

by Sergi Beltran Agulló

Dear all, please find attached a very basic QC for the 5 common samples plus an extra one (NA20524). We have not been able to fully test the pipeline in order to deliver this now, but it should be fine. We have seen different length profiles on the samples we have sequenced and 4 of the common ones have a more or less similar distribution. You will see that the extra one has very few reads and a different profile (mode at 15bp, also seen in NA20527). Workflow: 1) Trimming -> using far (fast adaptor removal) with a minimum of 6 bases overlap and a maximum mismatch of 2 bases every 10. We have done a very harsh trimming for this test; we can probably make it more strict and with several rounds. 2) Selection of uniquely mapping reads (mapping done with GEM+Bfast). 3) Generation of mature miRNA coordinates with tool from http://cm.jefferson.edu/downloadables/ 4) Reciprocal comparison (unique reads VS mature miRNA) with bedtools (only miRNA counts are attached here) The sequence that can clearly be read (CGCGACCTCAGATCAGACGTGGCGACCCGCTGA) has a "perfect" match with megablast on human genome. Best wishes, Sergi --------------------------------- Sergi Beltran Agulló Bioinformatics Analysis Group CNAG - National Center for Genomic Analysis Parc Científic Barcelona - Torre I Baldiri i Reixac 4, 2a p. 08028 Barcelona (+34)934033748 sbeltrana(a)pcb.ub.cat www.cnag.cat ---------------------------------

12 years, 8 months

[Geuvadis_rna_analysis] microRNA QC

by Natalja Kurbatova

Hi, QC results made by Mat Davis from EBI Anton Enright's is in attachment. The results are very similar to what Tuuli had. Guidelines and explanation of peaks around 35 bp are coming (Monday-Tuesday). Sorry for the delay and please let me know if you have any questions. Regards, Natalja -- Natalja Kurbatova, PhD Functional Genomics Group, EBI

12 years, 8 months

[Geuvadis_rna_analysis] Geuvadis RNAseq AG call on Thursday

by Tuuli Lappalainen

Hello all, We have the Geuvadis analysis group TC on Thursday (Feb 8) at 2pm. On the agenda: - updates on sequencing if needed - analysis group face-to-face meeting *Please fill the Doodle! http://www.doodle.com/24a4i3n8bkynhpwx *- small RNA QC - Manuel Rivas will present some slides on LOF analysis plans Here are the call details: Spain 902 125 136 Other countries +34 91 495 18 99 Participants' Pin-code: 764989* best regards, Tuuli -- Tuuli Lappalainen, PhD Department of Genetic Medicine and Development University of Geneva Medical School CMU / Rue Michel-Servet 1 1211 Geneva 4 Switzerland Tel. +41-(0)22-3795550 tuuli.lappalainen(a)unige.ch

12 years, 8 months

[Geuvadis_rna_analysis] Geuvadis RNAseq analysis group face-to-face meeting

by Tuuli Lappalainen

Dear all, The Geuvadis RNAseq analysis group is planning to have a face-to-face meeting in April. Please *fill in the Doodle by the end of the week* (Feb 12) if you think you would like to attend**so that we can fix the date of the meeting: *http://www.doodle.com/24a4i3n8bkynhpwx* The goal of the meeting is to present first results as well as plan and decide on future analyses. The 1.5-day meeting will probably take place in Geneva. best regards, Tuuli -- Tuuli Lappalainen, PhD Department of Genetic Medicine and Development University of Geneva Medical School CMU / Rue Michel-Servet 1 1211 Geneva 4 Switzerland Tel. +41-(0)22-3795550 tuuli.lappalainen(a)unige.ch

12 years, 8 months

[Geuvadis_rna_analysis] phiX

by P.A.C._t_Hoen＠lumc.nl

Dear all We are about to sequence the RNA-seq samples. We spike in phiX at 1% for QC reasons. Do people also still reserve one full lane for phiX to improve base calling? What have people done for their GEUVADIS RNA-seq samples? Best wishes Peter Dr. Peter A.C. 't Hoen Center for Human and Clinical Genetics Leiden University Medical Center Postal zone S4-P PO Box 9600 2300 RC Leiden The Netherlands phone: +31-71-5269421 fax: +31-71-5268285 e-mail: p.a.c.hoen(a)lumc.nl

12 years, 8 months

[Geuvadis_rna_analysis] Geuvadis seq data processing guidelines

by Tuuli Lappalainen

Hi all, Here are the guidelines for producing and submitting the fastq files. All this can be found from the wiki site, under Data Storage -> FTP (http://www.geuvadis.org/group/geuvadis/wikis/-/wiki/Main%20Geuvadis%20Wiki/…) If you don't have a password for the wiki, contact Gabrielle (gabrielle.bertier(a)crg.eu) best regards, Tuuli *FTP access* * The fastq files are to be uploaded to the Geuvadis private FTP account at EBI. Here are login details: o Host: ftp-private.ebi.ac.uk o User: geuvadis o Password: k2vP3kjJ o Directory: /upload/geuvadis/wp4_rnaseq/ o Contact Natalja Kurbatova (natalja at ebi.ac.uk) if you have technical problems. 1. Create fastq files * Use CASAVA 1.8, allow 1 mismatch in the index, demultiplex * Naming of fastq files: SAMPLE_ID.SeqLabNumber.M/MI_YYMMDD_Lane_Read.fastq.gz . SeqLabNumber has been given in the sample information sheets. M/MI stands for mRNA or miRNA sequencing. YYMMDD is the sequencing date. Example: NA12345.1.MI_111215_3_1.fastq.gz would be sample NA12345 miRNA-sequenced in Geneva on 2011-Dec-15 on lane 3. * Compress fastq files with either gzip or bzip2 2. Generate MD5 checksums for compressed fastq files files * The md5sum program is installed by default on most Unix, Linux and Unix like systems. o *Unix/Linux*: md5sum <file1> <file2> <etc> > myvalues.md5 o *Mac*: md5 <file1> <file2> <etc> > myvalues.md5 * This will create md5sum values for the files listed and save these values into a file called 'myvalues.md5' 3. Create a README file Link samples and uploaded files, and provide submitter info in a tab-separated file. An example attached. *4. Get sample information sheet * Find the filled sample information sheet that follows the template that was sent with the samples. If you're submitting only a part of your samples, please upload only that part of the file. E.g. "Geuvadis_samplesheet_mRNA_UNIGE_submission1.xlsx". *5. Upload * Upload the following files to ftp-private.ebi.ac.uk/upload/geuvadis/wp4_rnaseq/main_project/sequence_data/fastq/mrna or /mirna 1. Compressed fastq files 2. md5sum file 3. README file 4. sample information sheet * Data submission deadline* * The fastq submission deadline is February 15, 2011 * Please submit data when it's done - don't wait for the deadline. We don't want to transfer and map 2 x 500 files at the same time. * If there are unexpected delays in your data production, inform the other partners (especially Geneva) as soon as possible -- Tuuli Lappalainen, PhD Department of Genetic Medicine and Development University of Geneva Medical School CMU / Rue Michel-Servet 1 1211 Geneva 4 Switzerland Tel. +41-(0)22-3795550 tuuli.lappalainen(a)unige.ch

12 years, 8 months

Jump to page:

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

geuvadis_rna_analysis