Dear All,
attached are some fastQC examples (after adapter trimming) of the first
miRNAs sequenced in Kiel. We get a peak at 22 bp and a smaller one at at
17-18 bp. Like Tuuli, we are a bit short of mapped reads and did not
achieve 3M for all samples.
Comparing with Tuuli's read-lengths, I've noticed that we achieved a
more or less similar high peak at 22 bp. There's even the peak at 18 bp.
I'm assuming the GA IIx was used to sequence 36 bp reads, thus every
remaining rRNA or mRNA would be contained as untrimmed reads in the 36
bp fraction. We sequenced longer reads on the HiSeq and removed all
sequences larger than 36 bp after trimming (basically removing most rRNA
and mRNA fragments), thus they do not show in our plot.
We used cutadapt for trimming and run it three rounds per sample:
Parameter description:
-e = error rate
-m = minimum length
-M = maximum length
-O = minimum overlap length
1. Round - Trimming of (short) adapter sequence (TGGAATTCTCGGGTGCCAAGG).
With parameters -e 0.1 -m 14
2. Round - Trimming of (longer) PCR primer sequence
(TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG).
Parameters: -e 0.3 -O 20 - m14
The sequence was adjusted for the correct index. for each sample The
combination of a minimum overlap of 20 bp and more allowed mismatches
was used to remove bad-quality primer sequences.
3. Round - Trimming of polyA tails. Parameters: -e 0.1 -m 14 -M 36
Which also removes all sequences longer than 36 bp.
best wishes,
Matthias
--
Matthias Barann
Institute of Clinical Molecular Biology
Christian Albrechts University Kiel
Schittenhelmstr. 12
D-24105 Kiel, Germany
m.barann(a)ikmb.uni-kiel.de
+49 - (0)431 - 597 8681 (office)