[Geuvadis_rna_analysis] small RNA basic QC

Dear all, please find attached a very basic QC for the 5 common samples plus an extra one (NA20524). We have not been able to fully test the pipeline in order to deliver this now, but it should be fine. We have seen different length profiles on the samples we have sequenced and 4 of the common ones have a more or less similar distribution. You will see that the extra one has very few reads and a different profile (mode at 15bp, also seen in NA20527). Workflow: 1) Trimming -> using far (fast adaptor removal) with a minimum of 6 bases overlap and a maximum mismatch of 2 bases every 10. We have done a very harsh trimming for this test; we can probably make it more strict and with several rounds. 2) Selection of uniquely mapping reads (mapping done with GEM+Bfast). 3) Generation of mature miRNA coordinates with tool from http://cm.jefferson.edu/downloadables/ 4) Reciprocal comparison (unique reads VS mature miRNA) with bedtools (only miRNA counts are attached here) The sequence that can clearly be read (CGCGACCTCAGATCAGACGTGGCGACCCGCTGA) has a "perfect" match with megablast on human genome. Best wishes, Sergi --------------------------------- Sergi Beltran Agulló Bioinformatics Analysis Group CNAG - National Center for Genomic Analysis Parc Científic Barcelona - Torre I Baldiri i Reixac 4, 2a p. 08028 Barcelona (+34)934033748 sbeltrana(a)pcb.ub.cat www.cnag.cat ---------------------------------