Hi Matthias and others,
I noticed the read length discordance myself very recently, and was
going to bring it up. This is really unfortunate - people processing the
data in Barcelona didn't follow the explicit instructions of submitting
75 bp data. This is something that I should have checked though, and I
thought I had, but apparently I didn't for the mRNA data. However, I
don't think this will really affect things. The Barcelona samples don't
show worse mapping stats, and I definitely don't want to remap these
samples without a very strong reason.
Regarding the GEM mapping quality scores, *Paolo, Thasso and Micha, can
you please comment on this? *Matthias and Daniela, what do you mean by
referring to the example reads as being well or badly mapped? The
classifications below is the information I have from Paolo, but I don't
know the algorithms that they use to calculate the MAPQ. In my
understanding the qualities are calculated independently for the two
mates. I'm using reads with MAPQ >150, i.e. reads in categories 1 and 2
below. It depends on the analysis whether I require both mates to have
this quality (e.g. exon quantifications) or if I can just use a single
good-quality mate regardless of the quality of its mate (e.g. ASE).
1. Matches which are unique, and do not have any subdominant match:
251 >= MAPQ >= 255, XT=U
2. Matches which are unique, and have subdominant matches but a
different score:
175 >= MAPQ >= 181, XT=U
3. Matches which are putatively unique (not unique, but distinguishable
by score):
119 >= MAPQ >= 127, XT=U
4. Matches which are a perfect tie:
78 >= MAPQ >= 90, XT=R.
best regards,
Tuuli
Tuuli Lappalainen, PhD
Department of Genetic Medicine and Development
University of Geneva Medical School
CMU / Rue Michel-Servet 1
1211 Geneva 4
Switzerland
Tel. +41-(0)22-3795550
tuuli.lappalainen(a)unige.ch
On 7/4/12 3:24 PM, Matthias Barann wrote:
Dear all,
we noticed some inconsistencies in the read lengths of the GEM
mappings (I didn't check the BWA mappings, but it's probably the same).
Some samples appear to have up to 76 bp matched, while other samples
only have 75 bp. In regard to comparability this might cause some
(probably very little) differences between the samples.
i.e.
NA20589.1.M_111124_3.bam has 75 bp
NA20812.2.M_111216_6.bam has *76 bp*
NA20760.3.M_120202_5.bam has 75 bp
NA20783.4.M_120208_6.bam has 75 bp
NA20768.5.M_120131_1.bam has 75 bp
NA20798.6.M_120119_6.bam has 75 bp
NA20803.7.M_120219_1.bam has 75 bp
We checked some more files for institute 2, and they seem to have
generally 1 bp more than the others.
We're also a bit lost regarding GEM's quality score. We would like to
filter reads for good mapping quality, we're just not sure how to
accomplish this.
Below are two read pairs as an example.
The fist pair has a mapping quality of 180. The second read however
was terribly aligned.
The second pair has only a quality of 99, while the reads mapped much
better (at least I would say so).
We're not sure what's the reason for this.
Curiously, both reads of a pair get the same mapping quality. This
could be by intention (i.e. it's always the pair quality rather than
the read quality) or, which could also explain the quality differences
for the reads, both reads of the pair get the quality of the first
mapped read.
We're thankful for any suggestions on how to filter for 'good' mappings.
HWI-ST661:153:D0FTJACXX:8:2201:16410:93092 163
chr1 14704
*180 75M *= 14770 -134
CCCAGTCGTCCTCGTCCTCCTCTGCCTGTGGCTGCTGCGGTGGCGGCAGAGGAGGGATGGAGGCTGACACGCGGG
CCCFFFFFHHHGHJJJIGIJIIIIIJIJHIIJJJB?BFHG7@F@AB:9=(6=(;>B29<@###############
RG:Z:0 NM:i:7 XT:A:U md:Z:62T12
XA:Z:chr15,-102516387,75M,8;chr9,+14815,75M,10;chr16,+64389,19M1I1M2I52M,10;chr2,-114356235,75M,11;
HWI-ST661:153:D0FTJACXX:8:2201:16410:93092 83 chr1 14770
*180 39M1D22M1I3M2I1M1I2M4S *= 14704 134
ACACGCGGGCAAAGGCTCCTCCGGGCCCCTCACCAGCCCAGGTCCTTTCCCAGAGATGCCTTGGCTCGTGGCTGT
5@
9DDDDDDDDDC@BDDDDDDFHHIIIIJIHFJJJJIIJIJIJJIJJJJJJJJJJIIIJJJJHHHHHFFDDA11B
RG:Z:0 NM:i:7 XT:A:U md:Z:(4)2>1-1>2-T2>1-22>1+39
XA:Z:chr15,+102516328,1S1M2I4M3I1M1I1M1I24M1D36M,8;chr9,-14881,39M1D22M1I3M2
I1M1I2M4S,10;chr16,-64452,39M1D22M1I3M2I1M1I2M4S,10;chr2,+114356176,1S1M2I4M3I1M1I1M1I24M1D36M,11;
HWI-ST661:153:D0FTJACXX:8:2201:6270:52066 99
chr1 14582
*99 1M2I71M1S *= 14665 158
CCCTGGTTCCGTCACCCCCTCCCAGGGAAGCAGGTCTGAGCAGCTTGTCCTGGCTGTGTCAATGTCAGAGCAACA
@11ADFFFHHHHHIIJJJJIJJIJJJJHHJJIJJHIJJJIIGFGIIJIIJF@@EGDAE>?)).7?BDFFDCCCB@
RG:Z:0 NM:i:8 XT:A:U md:Z:1>2-21A5T29C13(1)
XA:Z:chrY,-59358087,75M,4;chrX,-155255081,75M,4;chr9,+14691,75M,7;chr2,-114356359,75M,7;chr16,+64266,75M,8;chr12,-90971,75M,8;
HWI-ST661:153:D0FTJACXX:8:2201:6270:52066 147 chr1 14665
*99 75M *= 14582 -158
GGGTCTGGGGGGGAAGGTGTCATGGAGCCCCCTAGGATTCCCAGTCGTCCTCGTCCTCCTCTGCCTGTGGCTGTG
<B@A<9;>@CAAADDDDCCC>CC=?;>FHCGGEGIGJJIIGGIHHIIIIJIIJIJIGJJIJIHHFDDFFFFDB@;
RG:Z:0 NM:i:8 XT:A:U md:Z:AG38G34
XA:Z:chrY,+59358002,75M,4;chrX,+155254996,75M,4;chr9,-14776,75M,7;chr2,+114356274,75M,7;chr16,-64350,58M1I1M2I11M1D2M,8;chr12,+90885,2M1D73M,8;
best wishes,
Matthias & Daniela
--
Matthias Barann
Institute of Clinical Molecular Biology
Christian Albrechts University Kiel
Schittenhelmstr. 12
D-24105 Kiel, Germany
m.barann(a)ikmb.uni-kiel.de
+49 - (0)431 - 597 8681 (office)
_______________________________________________
Geuvadis_rna_analysis mailing list
Geuvadis_rna_analysis(a)lists.crg.es
http://davinci.crg.es/mailman/listinfo/geuvadis_rna_analysis